##Goals of this file

1.Load the fastree unrooted tree. 2.Add tree to phyloseq object. 3.Visualize and inspect tree with ggtree. 4.Prune ASVs, if needed. 5.Root our tree. 6.Combine new tree with a phyloseq object. 7.Save 2 phyloseq objects: 1. Unrooted tree phyloseq object 2. Rooted tree phyloseq object.

##Set the seed

set.seed(2443)

##Load Packages

pacman::p_load(tidyverse, phyloseq, ggtree, phytools,
               install = FALSE)

##Load data files

# Preprocessed phyloseq object 
load("data/02_PreProcessing/raw_preprocessed_physeq.RData")
raw_preprocessed_physeq
## phyloseq-class experiment-level object
## otu_table()   OTU Table:         [ 2969 taxa and 109 samples ]
## sample_data() Sample Data:       [ 109 samples by 18 sample variables ]
## tax_table()   Taxonomy Table:    [ 2969 taxa by 9 taxonomic ranks ]

##Make different physeq objects for DNA and RNA samples

raw_preprocessed_physeq_DNA <- subset_samples(raw_preprocessed_physeq,nuc_acid_type == "DNA")

raw_preprocessed_physeq_RNA <- subset_samples(raw_preprocessed_physeq,nuc_acid_type == "RNA")
# Load in the tree! 
unrooted_tree <- read.tree("data/03_Phylogenetic_Tree/ASVs_unrooted.tree")
unrooted_tree
## 
## Phylogenetic tree with 2969 tips and 2967 internal nodes.
## 
## Tip labels:
##   ASV_1553, ASV_2305, ASV_1749, ASV_1964, ASV_1880, ASV_1409, ...
## Node labels:
##   , 0.920, 0.795, 0.990, 0.955, 0.761, ...
## 
## Unrooted; includes branch lengths.
str(unrooted_tree)
## List of 5
##  $ edge       : int [1:5935, 1:2] 2970 2971 2972 2973 2974 2975 2975 2974 2976 2977 ...
##  $ edge.length: num [1:5935] 0.03971 0.01402 0.06219 0.03807 0.00586 ...
##  $ Nnode      : int 2967
##  $ node.label : chr [1:2967] "" "0.920" "0.795" "0.990" ...
##  $ tip.label  : chr [1:2969] "ASV_1553" "ASV_2305" "ASV_1749" "ASV_1964" ...
##  - attr(*, "class")= chr "phylo"
##  - attr(*, "order")= chr "cladewise"

##Merge Phyloseq with tree

# Intuition check 
stopifnot(ntaxa(raw_preprocessed_physeq) == ntaxa(unrooted_tree))

# Merge the tree with the phyloseq object 
unrooted_physeq <- merge_phyloseq(raw_preprocessed_physeq, unrooted_tree)
## Found more than one class "phylo" in cache; using the first, from namespace 'phyloseq'
## Also defined by 'tidytree'
## Found more than one class "phylo" in cache; using the first, from namespace 'phyloseq'
## Also defined by 'tidytree'
## Found more than one class "phylo" in cache; using the first, from namespace 'phyloseq'
## Also defined by 'tidytree'
## Found more than one class "phylo" in cache; using the first, from namespace 'phyloseq'
## Also defined by 'tidytree'
## Found more than one class "phylo" in cache; using the first, from namespace 'phyloseq'
## Also defined by 'tidytree'
## Found more than one class "phylo" in cache; using the first, from namespace 'phyloseq'
## Also defined by 'tidytree'
## Found more than one class "phylo" in cache; using the first, from namespace 'phyloseq'
## Also defined by 'tidytree'
unrooted_physeq_DNA <- merge_phyloseq(raw_preprocessed_physeq_DNA,unrooted_tree)
## Found more than one class "phylo" in cache; using the first, from namespace 'phyloseq'
## Also defined by 'tidytree'
## Found more than one class "phylo" in cache; using the first, from namespace 'phyloseq'
## Also defined by 'tidytree'
## Found more than one class "phylo" in cache; using the first, from namespace 'phyloseq'
## Also defined by 'tidytree'
## Found more than one class "phylo" in cache; using the first, from namespace 'phyloseq'
## Also defined by 'tidytree'
unrooted_physeq_RNA <- merge_phyloseq(raw_preprocessed_physeq_RNA,unrooted_tree)
## Found more than one class "phylo" in cache; using the first, from namespace 'phyloseq'
## Also defined by 'tidytree'
## Found more than one class "phylo" in cache; using the first, from namespace 'phyloseq'
## Also defined by 'tidytree'
## Found more than one class "phylo" in cache; using the first, from namespace 'phyloseq'
## Also defined by 'tidytree'
## Found more than one class "phylo" in cache; using the first, from namespace 'phyloseq'
## Also defined by 'tidytree'
unrooted_physeq
## phyloseq-class experiment-level object
## otu_table()   OTU Table:         [ 2969 taxa and 109 samples ]
## sample_data() Sample Data:       [ 109 samples by 18 sample variables ]
## tax_table()   Taxonomy Table:    [ 2969 taxa by 9 taxonomic ranks ]
## phy_tree()    Phylogenetic Tree: [ 2969 tips and 2967 internal nodes ]
unrooted_physeq_DNA
## phyloseq-class experiment-level object
## otu_table()   OTU Table:         [ 2969 taxa and 56 samples ]
## sample_data() Sample Data:       [ 56 samples by 18 sample variables ]
## tax_table()   Taxonomy Table:    [ 2969 taxa by 9 taxonomic ranks ]
## phy_tree()    Phylogenetic Tree: [ 2969 tips and 2967 internal nodes ]
unrooted_physeq_RNA
## phyloseq-class experiment-level object
## otu_table()   OTU Table:         [ 2969 taxa and 53 samples ]
## sample_data() Sample Data:       [ 53 samples by 18 sample variables ]
## tax_table()   Taxonomy Table:    [ 2969 taxa by 9 taxonomic ranks ]
## phy_tree()    Phylogenetic Tree: [ 2969 tips and 2967 internal nodes ]

##Plot tree with ggtree

# Make a basic tree
kingdom_tree <- 
  ggtree(unrooted_physeq) + 
  # color tips by kingdom 
  geom_tippoint(mapping = aes(color = Kingdom)) + 
  scale_color_manual(values = c("goldenrod1", "cornflowerblue", "grey")) +
  # Add title 
  labs(title = "Unrooted Tree") + 
  #move the legend to the bottom 
  theme(legend.position = "bottom"); kingdom_tree

kingdom_tree_DNA <- 
  ggtree(unrooted_physeq_DNA) + 
  # color tips by kingdom 
  geom_tippoint(mapping = aes(color = Kingdom)) + 
  scale_color_manual(values = c("goldenrod1", "cornflowerblue", "grey")) +
  # Add title 
  labs(title = "Unrooted Tree DNA Samples") + 
  #move the legend to the bottom 
  theme(legend.position = "bottom"); kingdom_tree

kingdom_tree_RNA <- 
  ggtree(unrooted_physeq_RNA) + 
  # color tips by kingdom 
  geom_tippoint(mapping = aes(color = Kingdom)) + 
  scale_color_manual(values = c("goldenrod1", "cornflowerblue", "grey")) +
  # Add title 
  labs(title = "Unrooted Tree RNA Samples") + 
  #move the legend to the bottom 
  theme(legend.position = "bottom"); kingdom_tree

kingdom_tree

kingdom_tree_DNA

kingdom_tree_RNA

kingdom_node_tree <- 
  kingdom_tree + 
  # Add the node label 
  geom_text(aes(label=node), hjust= -0.5, vjust = -0.3, size = 2)

kingdom_node_tree_DNA <- 
  kingdom_tree_DNA + 
  # Add the node label 
  geom_text(aes(label=node), hjust= -0.5, vjust = -0.3, size = 2)

kingdom_node_tree_RNA <- 
  kingdom_tree_RNA + 
  # Add the node label 
  geom_text(aes(label=node), hjust= -0.5, vjust = -0.3, size = 2)

kingdom_node_tree

kingdom_node_tree_DNA

kingdom_node_tree_RNA

# View a specific clade 
# Zoom in on origin tree: Node 1721
viewClade(kingdom_node_tree + 
          labs(title = "Unrooted Tree: Node 1721"), 
          node = 1721)

# View a specific clade 
# Zoom in on origin tree: Node 1743
viewClade(kingdom_node_tree + 
          labs(title = "Unrooted Tree: Node 1743"), 
          node = 1743)

viewClade(kingdom_node_tree + 
          labs(title = "Unrooted Tree: Node 4605") + 
          geom_text(aes(label=ASV)), 
          node = 4605)
## Warning: Removed 2987 rows containing missing values or values outside the scale range
## (`geom_text()`).

unrooted_physeq %>%
  subset_taxa(., ASV == "ASV_1167") %>%
  tax_table() %>%
  data.frame()
## Found more than one class "phylo" in cache; using the first, from namespace 'phyloseq'
## Also defined by 'tidytree'
## Found more than one class "phylo" in cache; using the first, from namespace 'phyloseq'
## Also defined by 'tidytree'
## Warning in prune_taxa(taxa, phy_tree(x)): prune_taxa attempted to reduce tree to 1 or fewer tips.
##  tree replaced with NULL.
##           Kingdom Phylum Class Order Family Genus Species      ASV
## ASV_1167 Bacteria   <NA>  <NA>  <NA>   <NA>  <NA>    <NA> ASV_1167
##                                                                                                                                                                                                                                                          ASVseq
## ASV_1167 GAGGGGAGCAAGTGTTCTACAGTCAAACTGGGCGTAAAGGGTTCTCCGGCGGAAATGGGTGTGTAGAGGGGTTTGTTCCACCTGTCAAGTGGGACCATCCTCTAAACTCTATTTCATGAGTTGGAGCGGCGAGGGCGGGATTCCAGGACGAGCGTTAGCATGCTTAGACGCCTGGAGGACGGCCACGGGCGCAGGCCTCCCTCGAGCTCCGACTGACGCTTTGGAACGAAAGCGTGGGGAGCGATC

We looked at both ASV 375 and 1167 because of the length of the node, but after blasting the sequence, it appears they just originate from the 16S gene of uncharacterized bacteria so we will not be removing these sequences.

##Midroot Tree

new_unrooted_tree <- phy_tree(unrooted_physeq)
new_unrooted_tree_DNA <- phy_tree(unrooted_physeq_DNA)
new_unrooted_tree_RNA <- phy_tree(unrooted_physeq_RNA)

is.rooted(new_unrooted_tree)
## [1] FALSE
is.rooted(new_unrooted_tree_DNA)
## [1] FALSE
is.rooted(new_unrooted_tree_RNA)
## [1] FALSE
# Let's midpoint root the tree
midpoint_rooted_tree <- midpoint.root(new_unrooted_tree)
midpoint_rooted_tree_DNA <- midpoint.root(new_unrooted_tree_DNA)
midpoint_rooted_tree_RNA <- midpoint.root(new_unrooted_tree_RNA)

# Is the new tree rooted?
is.rooted(midpoint_rooted_tree)
## [1] TRUE
is.rooted(midpoint_rooted_tree_DNA)
## [1] TRUE
is.rooted(midpoint_rooted_tree_RNA)
## [1] TRUE
# Merge tree with the physeq
midroot_physeq <- merge_phyloseq(raw_preprocessed_physeq, midpoint_rooted_tree)
## Found more than one class "phylo" in cache; using the first, from namespace 'phyloseq'
## Also defined by 'tidytree'
## Found more than one class "phylo" in cache; using the first, from namespace 'phyloseq'
## Also defined by 'tidytree'
## Found more than one class "phylo" in cache; using the first, from namespace 'phyloseq'
## Also defined by 'tidytree'
## Found more than one class "phylo" in cache; using the first, from namespace 'phyloseq'
## Also defined by 'tidytree'
midroot_physeq_DNA <- merge_phyloseq(raw_preprocessed_physeq_DNA, midpoint_rooted_tree_DNA)
## Found more than one class "phylo" in cache; using the first, from namespace 'phyloseq'
## Also defined by 'tidytree'
## Found more than one class "phylo" in cache; using the first, from namespace 'phyloseq'
## Also defined by 'tidytree'
## Found more than one class "phylo" in cache; using the first, from namespace 'phyloseq'
## Also defined by 'tidytree'
## Found more than one class "phylo" in cache; using the first, from namespace 'phyloseq'
## Also defined by 'tidytree'
midroot_physeq_RNA <- merge_phyloseq(raw_preprocessed_physeq_RNA, midpoint_rooted_tree_RNA)
## Found more than one class "phylo" in cache; using the first, from namespace 'phyloseq'
## Also defined by 'tidytree'
## Found more than one class "phylo" in cache; using the first, from namespace 'phyloseq'
## Also defined by 'tidytree'
## Found more than one class "phylo" in cache; using the first, from namespace 'phyloseq'
## Also defined by 'tidytree'
## Found more than one class "phylo" in cache; using the first, from namespace 'phyloseq'
## Also defined by 'tidytree'
midroot_physeq
## phyloseq-class experiment-level object
## otu_table()   OTU Table:         [ 2969 taxa and 109 samples ]
## sample_data() Sample Data:       [ 109 samples by 18 sample variables ]
## tax_table()   Taxonomy Table:    [ 2969 taxa by 9 taxonomic ranks ]
## phy_tree()    Phylogenetic Tree: [ 2969 tips and 2968 internal nodes ]
# Quick inspection of tree 
ggtree(midroot_physeq) + 
  geom_tippoint(mapping = aes(color = Kingdom)) + geom_text(aes(label=node), hjust= -0.5, vjust = -0.3, size = 2)

##Save to a new phyloseq object

# Save both phyloseq objects with our tree object to one .RData file 
save(list = c("unrooted_physeq", "midroot_physeq","unrooted_physeq_DNA","midroot_physeq_DNA","unrooted_physeq_RNA","midroot_physeq_RNA"),
     file = "data/03_Phylogenetic_Tree/phytree_preprocessed_physeq.RData")

##Session Info

# Ensure reproducibility 
devtools::session_info()
## ─ Session info ───────────────────────────────────────────────────────────────
##  setting  value
##  version  R version 4.3.2 (2023-10-31)
##  os       Rocky Linux 9.0 (Blue Onyx)
##  system   x86_64, linux-gnu
##  ui       X11
##  language (EN)
##  collate  en_US.UTF-8
##  ctype    en_US.UTF-8
##  tz       America/New_York
##  date     2024-04-28
##  pandoc   3.1.1 @ /usr/lib/rstudio-server/bin/quarto/bin/tools/ (via rmarkdown)
## 
## ─ Packages ───────────────────────────────────────────────────────────────────
##  package           * version    date (UTC) lib source
##  ade4                1.7-22     2023-02-06 [1] CRAN (R 4.3.2)
##  ape               * 5.7-1      2023-03-13 [2] CRAN (R 4.3.2)
##  aplot               0.2.2      2023-10-06 [1] CRAN (R 4.3.2)
##  Biobase             2.62.0     2023-10-24 [2] Bioconductor
##  BiocGenerics        0.48.1     2023-11-01 [2] Bioconductor
##  biomformat          1.30.0     2023-10-24 [1] Bioconductor
##  Biostrings          2.70.1     2023-10-25 [2] Bioconductor
##  bitops              1.0-7      2021-04-24 [2] CRAN (R 4.3.2)
##  bslib               0.5.1      2023-08-11 [2] CRAN (R 4.3.2)
##  cachem              1.0.8      2023-05-01 [2] CRAN (R 4.3.2)
##  callr               3.7.3      2022-11-02 [2] CRAN (R 4.3.2)
##  cli                 3.6.1      2023-03-23 [2] CRAN (R 4.3.2)
##  cluster             2.1.4      2022-08-22 [2] CRAN (R 4.3.2)
##  clusterGeneration   1.3.8      2023-08-16 [1] CRAN (R 4.3.2)
##  coda                0.19-4     2020-09-30 [2] CRAN (R 4.3.2)
##  codetools           0.2-19     2023-02-01 [2] CRAN (R 4.3.2)
##  colorspace          2.1-0      2023-01-23 [2] CRAN (R 4.3.2)
##  combinat            0.0-8      2012-10-29 [1] CRAN (R 4.3.2)
##  crayon              1.5.2      2022-09-29 [2] CRAN (R 4.3.2)
##  data.table          1.14.8     2023-02-17 [2] CRAN (R 4.3.2)
##  devtools            2.4.4      2022-07-20 [2] CRAN (R 4.2.1)
##  digest              0.6.33     2023-07-07 [2] CRAN (R 4.3.2)
##  doParallel          1.0.17     2022-02-07 [2] CRAN (R 4.3.2)
##  dplyr             * 1.1.3      2023-09-03 [2] CRAN (R 4.3.2)
##  ellipsis            0.3.2      2021-04-29 [2] CRAN (R 4.3.2)
##  evaluate            0.23       2023-11-01 [2] CRAN (R 4.3.2)
##  expm                0.999-9    2024-01-11 [1] CRAN (R 4.3.2)
##  fansi               1.0.5      2023-10-08 [2] CRAN (R 4.3.2)
##  farver              2.1.1      2022-07-06 [2] CRAN (R 4.3.2)
##  fastmap             1.1.1      2023-02-24 [2] CRAN (R 4.3.2)
##  fastmatch           1.1-4      2023-08-18 [1] CRAN (R 4.3.2)
##  forcats           * 1.0.0      2023-01-29 [1] CRAN (R 4.3.2)
##  foreach             1.5.2      2022-02-02 [2] CRAN (R 4.3.2)
##  fs                  1.6.3      2023-07-20 [2] CRAN (R 4.3.2)
##  generics            0.1.3      2022-07-05 [2] CRAN (R 4.3.2)
##  GenomeInfoDb        1.38.0     2023-10-24 [2] Bioconductor
##  GenomeInfoDbData    1.2.11     2023-11-07 [2] Bioconductor
##  ggfun               0.1.4      2024-01-19 [1] CRAN (R 4.3.2)
##  ggplot2           * 3.5.0      2024-02-23 [2] CRAN (R 4.3.2)
##  ggplotify           0.1.2      2023-08-09 [1] CRAN (R 4.3.2)
##  ggtree            * 3.10.1     2024-02-25 [1] Bioconductor 3.18 (R 4.3.2)
##  glue                1.6.2      2022-02-24 [2] CRAN (R 4.3.2)
##  gridGraphics        0.5-1      2020-12-13 [1] CRAN (R 4.3.2)
##  gtable              0.3.4      2023-08-21 [2] CRAN (R 4.3.2)
##  highr               0.10       2022-12-22 [2] CRAN (R 4.3.2)
##  hms                 1.1.3      2023-03-21 [1] CRAN (R 4.3.2)
##  htmltools           0.5.7      2023-11-03 [2] CRAN (R 4.3.2)
##  htmlwidgets         1.6.2      2023-03-17 [2] CRAN (R 4.3.2)
##  httpuv              1.6.12     2023-10-23 [2] CRAN (R 4.3.2)
##  igraph              1.5.1      2023-08-10 [2] CRAN (R 4.3.2)
##  IRanges             2.36.0     2023-10-24 [2] Bioconductor
##  iterators           1.0.14     2022-02-05 [2] CRAN (R 4.3.2)
##  jquerylib           0.1.4      2021-04-26 [2] CRAN (R 4.3.2)
##  jsonlite            1.8.7      2023-06-29 [2] CRAN (R 4.3.2)
##  knitr               1.45       2023-10-30 [2] CRAN (R 4.3.2)
##  labeling            0.4.3      2023-08-29 [2] CRAN (R 4.3.2)
##  later               1.3.1      2023-05-02 [2] CRAN (R 4.3.2)
##  lattice             0.21-9     2023-10-01 [2] CRAN (R 4.3.2)
##  lazyeval            0.2.2      2019-03-15 [2] CRAN (R 4.3.2)
##  lifecycle           1.0.3      2022-10-07 [2] CRAN (R 4.3.2)
##  lubridate         * 1.9.3      2023-09-27 [1] CRAN (R 4.3.2)
##  magrittr            2.0.3      2022-03-30 [2] CRAN (R 4.3.2)
##  maps              * 3.4.2      2023-12-15 [1] CRAN (R 4.3.2)
##  MASS                7.3-60     2023-05-04 [2] CRAN (R 4.3.2)
##  Matrix              1.6-1.1    2023-09-18 [2] CRAN (R 4.3.2)
##  memoise             2.0.1      2021-11-26 [2] CRAN (R 4.3.2)
##  mgcv                1.9-0      2023-07-11 [2] CRAN (R 4.3.2)
##  mime                0.12       2021-09-28 [2] CRAN (R 4.3.2)
##  miniUI              0.1.1.1    2018-05-18 [2] CRAN (R 4.3.2)
##  mnormt              2.1.1      2022-09-26 [1] CRAN (R 4.3.2)
##  multtest            2.58.0     2023-10-24 [1] Bioconductor
##  munsell             0.5.0      2018-06-12 [2] CRAN (R 4.3.2)
##  nlme                3.1-163    2023-08-09 [2] CRAN (R 4.3.2)
##  numDeriv            2016.8-1.1 2019-06-06 [1] CRAN (R 4.3.2)
##  optimParallel       1.0-2      2021-02-11 [1] CRAN (R 4.3.2)
##  pacman              0.5.1      2019-03-11 [1] CRAN (R 4.3.2)
##  patchwork           1.1.3      2023-08-14 [2] CRAN (R 4.3.2)
##  permute             0.9-7      2022-01-27 [1] CRAN (R 4.3.2)
##  phangorn            2.11.1     2023-01-23 [1] CRAN (R 4.3.2)
##  phyloseq          * 1.46.0     2023-10-24 [1] Bioconductor
##  phytools          * 2.1-1      2024-01-09 [1] CRAN (R 4.3.2)
##  pillar              1.9.0      2023-03-22 [2] CRAN (R 4.3.2)
##  pkgbuild            1.4.2      2023-06-26 [2] CRAN (R 4.3.2)
##  pkgconfig           2.0.3      2019-09-22 [2] CRAN (R 4.3.2)
##  pkgload             1.3.3      2023-09-22 [2] CRAN (R 4.3.2)
##  plyr                1.8.9      2023-10-02 [2] CRAN (R 4.3.2)
##  prettyunits         1.2.0      2023-09-24 [2] CRAN (R 4.3.2)
##  processx            3.8.2      2023-06-30 [2] CRAN (R 4.3.2)
##  profvis             0.3.8      2023-05-02 [2] CRAN (R 4.3.2)
##  promises            1.2.1      2023-08-10 [2] CRAN (R 4.3.2)
##  ps                  1.7.5      2023-04-18 [2] CRAN (R 4.3.2)
##  purrr             * 1.0.2      2023-08-10 [2] CRAN (R 4.3.2)
##  quadprog            1.5-8      2019-11-20 [1] CRAN (R 4.3.2)
##  R6                  2.5.1      2021-08-19 [2] CRAN (R 4.3.2)
##  Rcpp                1.0.11     2023-07-06 [2] CRAN (R 4.3.2)
##  RCurl               1.98-1.13  2023-11-02 [2] CRAN (R 4.3.2)
##  readr             * 2.1.5      2024-01-10 [1] CRAN (R 4.3.2)
##  remotes             2.4.2.1    2023-07-18 [2] CRAN (R 4.3.2)
##  reshape2            1.4.4      2020-04-09 [2] CRAN (R 4.3.2)
##  rhdf5               2.46.1     2023-11-29 [1] Bioconductor 3.18 (R 4.3.2)
##  rhdf5filters        1.14.1     2023-11-06 [1] Bioconductor
##  Rhdf5lib            1.24.2     2024-02-07 [1] Bioconductor 3.18 (R 4.3.2)
##  rlang               1.1.2      2023-11-04 [2] CRAN (R 4.3.2)
##  rmarkdown           2.25       2023-09-18 [2] CRAN (R 4.3.2)
##  rstudioapi          0.15.0     2023-07-07 [2] CRAN (R 4.3.2)
##  S4Vectors           0.40.1     2023-10-26 [2] Bioconductor
##  sass                0.4.7      2023-07-15 [2] CRAN (R 4.3.2)
##  scales              1.3.0      2023-11-28 [2] CRAN (R 4.3.2)
##  scatterplot3d       0.3-44     2023-05-05 [1] CRAN (R 4.3.2)
##  sessioninfo         1.2.2      2021-12-06 [2] CRAN (R 4.3.2)
##  shiny               1.7.5.1    2023-10-14 [2] CRAN (R 4.3.2)
##  stringi             1.7.12     2023-01-11 [2] CRAN (R 4.3.2)
##  stringr           * 1.5.0      2022-12-02 [2] CRAN (R 4.3.2)
##  survival            3.5-7      2023-08-14 [2] CRAN (R 4.3.2)
##  tibble            * 3.2.1      2023-03-20 [2] CRAN (R 4.3.2)
##  tidyr             * 1.3.0      2023-01-24 [2] CRAN (R 4.3.2)
##  tidyselect          1.2.0      2022-10-10 [2] CRAN (R 4.3.2)
##  tidytree            0.4.6      2023-12-12 [1] CRAN (R 4.3.2)
##  tidyverse         * 2.0.0      2023-02-22 [1] CRAN (R 4.3.2)
##  timechange          0.3.0      2024-01-18 [1] CRAN (R 4.3.2)
##  treeio              1.26.0     2023-10-24 [1] Bioconductor
##  tzdb                0.4.0      2023-05-12 [1] CRAN (R 4.3.2)
##  urlchecker          1.0.1      2021-11-30 [2] CRAN (R 4.3.2)
##  usethis             2.2.2      2023-07-06 [2] CRAN (R 4.3.2)
##  utf8                1.2.4      2023-10-22 [2] CRAN (R 4.3.2)
##  vctrs               0.6.4      2023-10-12 [2] CRAN (R 4.3.2)
##  vegan               2.6-4      2022-10-11 [1] CRAN (R 4.3.2)
##  withr               2.5.2      2023-10-30 [2] CRAN (R 4.3.2)
##  xfun                0.41       2023-11-01 [2] CRAN (R 4.3.2)
##  xtable              1.8-4      2019-04-21 [2] CRAN (R 4.3.2)
##  XVector             0.42.0     2023-10-24 [2] Bioconductor
##  yaml                2.3.7      2023-01-23 [2] CRAN (R 4.3.2)
##  yulab.utils         0.1.4      2024-01-28 [1] CRAN (R 4.3.2)
##  zlibbioc            1.48.0     2023-10-24 [2] Bioconductor
## 
##  [1] /home/dt473/R/x86_64-pc-linux-gnu-library/4.3
##  [2] /programs/R-4.3.2/library
## 
## ──────────────────────────────────────────────────────────────────────────────